- How do I log out of BioNavigator?
You log out of BioNavigator by quitting your browser or using the Log Out button.
- What file formats can I upload into BioNavigator?
BioNavigator allows you to upload from File Manager most of the standard file formats for the file types that can be used as input for the programs in BioNavigator. Note that there is a limit of 1 MB to the size of the files that can be uploaded.
BioNavigator can upload the following file types in these formats:
| File types: |
File formats: |
| Nucleotide and protein sequences |
Raw (Staden), EMBL, Swiss-Prot, Genbank, PIR (CODATA), ASN.1, fasta, GCG, NBRF, IG |
| Nucleotide and protein sequence alignments |
MSF, fasta, NBRF, GenBank, EMBL, Phylip, ClustalW |
| Phylogenetic trees |
Phylip (Newick) |
| Plain text |
Text only |
| Protein structure files |
PDB |
| Sets (multiple sequence files) |
FASTA |
| Trace files |
|
- How can I upload multiple sequence files simultaneously?
You can upload multiple sequence files into BioNavigator from File Manager. Note that there is a limit of 1 MB to the size of the files that can be uploaded. From the upload window select set of nucleotide/protein sequences as the file type and select from your desk top either:
- a zipped or compressed file. You can zip or compress multiple sequence files using e.g. DropZip (Windows and Mac) WinZip for Windows or MacZip (freeware) for Mac OS. A zipped or compressed file will be automatically unzipped (decompressed) and saved as a set containing the individual files.
- a set of sequence files in FASTA format e.g.:
>filename1
gagattagagagggaacctga etc.
>filename2
atatttacctctagacgtaaaaa etc.
>filename3
agaggatgtgaatagtgtgtaaa etc.
etc.)
|
- Exactly what programs are available on BioNavigator?
The life scientists who have designed BioNavigator have searched the world to bring together the most complete list of analytical programs available through the Internet. BioNavigator provides access to more than 140 analytical programs (for full details of these programs, see Program Index) – with more to be added in future. Features of the BioNavigator system include functions in the following areas:
- Gene detection and translation
- Mapping
- Molecular evolution
- Molecular modeling
- Motif and pattern analysis
- Multiple sequence analysis
- Nucleic acid structure and analysis
- Pairwise sequence comparison
- PCR primer design
- Sequence family construction and searching
- Protein structure and function
- Sequence database similarity search
- Sequence file management
- Statistical analysis
|
- I'm not sure which program I need to use.
You may have some idea of the kind of analysis you want to perform (e.g. build a phylogenetic tree, or do a multiple sequence alignment) but not know the specific program to use. In this case, you can use the Protocols section of BioNavigator. These are easy to use step-by-step guides that walk you through complex analyses. The Protocols provide you with a list of tasks to choose from (e.g. phylogenetic analyses, designing PCR primers, finding similar sequences, producing multiple sequence alignments, and molecular modeling). To begin, simply click on one of the more specific topics within each task.
Alternatively, you can just type some keywords such as "phylogenetic tree" or "multiple sequence alignment" in the  at the top of any BioNavigator page. The system will suggest some available programs that may be of help to you.
- I have a sequence (or group of sequences) I want to analyze.
If you have a sequence, or group of sequences, and are not quite sure which programs you can use to analyze it, the best place to start is the Work Bench in BioNavigator. Just check the boxes next to the sequence(s) you want to analyze (or paste a sequence(s) or a list of database accession numbers into the entry box), click on the GO >>> next to Show all appropriate programs at the top of the page, and BioNavigator will list the programs available for analyzing your selection.
Alternatively, when you view a file from the File Manager, the Work Bench, or from the Results page, you can launch any program that can use this file as input from an appropriate programs menu at the top of the page.
[Back to contents]
- I want to use a particular program (e.g. BLAST).
If you know the name of the program you want to use, you can launch this program directly from the Program Index section of BioNavigator.
This index lists the programs available, grouped either by function, package, the type of information the program can use as input, alphabetically and all Macros.
Just locate the program or Macro you want to use in the list then click on the SELECT button next to its name. BioNavigator will then present you with the list of files in your account that the selected program can use as input. Just check the box next to the file(s) that you want to analyze (or paste in a sequence(s) or a list of database accession numbers in the PASTE SEQUENCE(S) OR DATABASE ACCESSION(S) box, or enter a single database accession number in the CHOOSE A DATABASE ENTRY section) and click on the GO >>> button at the top of the page to proceed with the analysis.
- What is a list of FAVORITES?
Whenever you run a program or Macro, you will be given the option of selecting whether or not you wish to add it to your list of favorites. A comprehensive listing of your favorites appears in the Show all appropriate programs menu section of the Work Bench, and can also be viewed from the FAVORITES tab in Program Index. Select a program or Macro (and suitable input files) and click GO to run it. When viewing a particular file, those programs and Macros from this list suitable for using this file as input are displayed in the Show all appropriate programs menu and can also be run by selecting them and clicking GO >>>.
Your favorites list can become quite large and you may wish to remove some of the programs from it. To do this, click on the FAVORITES tab in the Program Index. Check the boxes next to the programs you wish to delete and then click on the DELETE button.
- What is the Autorefresh function in Results?
Autorefresh allows you to refresh the results window every 60 seconds. This is useful, if there are any queued or running programs, as it allows you to see when a program has finished. You can choose to turn this option off by clicking the checkbox.
Note:
- If there are no programs running or queued, Autorefresh is automatically turned off.
- If Autorefresh alternates between showing a program as running, and not showing it at all you need to change your Internet Explorer settings.
- Can I find out what options I used to obtain a particular result?
Yes. BioNavigator automatically saves the option settings you select each time you run a program. These can be accessed from Results by clicking on the program name.
- What are Helper applications?
Helper applications are programs which you can download from the internet and install on your computer in order to enhance the functionality of BioNavigator for example to produce publication quality images. These helper programs work with your browser to allow you to display and further manipulate special file types such as phylogenetic trees, multiple sequence alignments, protein structure files, and postscript files.
- How do I use Helper applications?
Each Helper application requires a ONE-OFF download, installation and browser configuration procedure before you can use it. Once you have downloaded the program from the internet, installed it on your computer and configured you browser to recognize the specific file type you can simply click the LAUNCH HELPER button and the file will automatically be downloaded AND opened by the helper application.
- How are files and program results stored in my BioNavigator account?
Whenever you save the results of a Text Search or save the results of a program's output, the files are stored in your account on our server within your designated project folders. They can be accessed through the File Manager, the Work Bench, or through Results. Within the File Manager you cannot create project folders within already existing project folders.
Whenever you run a program, the results of a program's output are automatically made available in Results. Here, each result contains detailed information, which include your output files, links to your input files and links to program options used.
- Why is more disk space used on my account than the total amount of space used in all of my project folders?
All of your result information does occupy additional space on your account, though it is not stored within a project folder, and isn't visible from within BioNavigator. The amount of additional storage space is minimal compared to the size of the results files. If you find that you are running out of storage space on your account, you may free some up by deleting results that you no longer wish to keep from the Results section.
- How can I retrieve files or project folders that I've deleted by mistake?
If you accidentally deleted a file or project folder in the File Manager by mistake, do not despair. The File Manager contains the Undelete feature, which allows you to retrieve files and project folders that you deleted by mistake. Note: If you delete a result from Results it is not possible to retrieve it.
- If I view a large file, my browser crashes (e.g. BLAST result).
When viewing a file, it will be displayed in its formatted version by default. However, if it is a large file (usually generated from running a sequence database similarity search program such as BLAST), you may have problems viewing the formatted version in your browser.
- When I resize my browser window, it causes BioNavigator to reset back to the Welcome page.
Due to the way both Internet Explorer and Netscape display frames, resizing some windows can cause the page to reload. We suggest you resize your window to suit before entering BioNavigator to avoid this browser related issue.
- When I resize my browser window, I lose buttons or images in BioNavigator, or various functions drop out.
As with the question above, this is caused by the way both browsers view the javascript used to provide extended functionality in BioNavigator. If you experience this issue hold down the Shift key on your computer's keyboard, and click on the Reload button (for Netscape) or the Refresh button (for Internet Explorer). This will reset BioNavigator back to normal on most platforms. As with the above question this issue can be avoided by resizing your window to suit before entering BioNavigator.
- When I delete a file in File Manager it still appears in Work Bench.
If you are using Internet Explorer you may find that even though you have deleted a file in File Manager it is still present in Work Bench or if you click the BACK button of your browser. If this happens you will need to change the cache settings:
If you are using IE 4.5 on Macintosh: Go to Edit, Preferences, Web Browser, Advanced. Find the Cache section and set the Update Pages to Always.
If you are using IE 5 on Windows - Go to Tools, Internet Options, General. In the Temporary Files section, click on the Settings button. Change Check for newer versions of stored pages to Every visit to the page.
- Why does my help window not scroll down at times?
Sometimes the down scroll arrow does not work in the help window or will stop working when you change between help documents. This is a problem experienced by Netscape users on Macintosh computers. To regain the scrolling function try resizing the help window slightly.
[Back to top]
|
bioinformatics workspace
